The Proceedings of the Eighth International Conference on Creationism (2018)

“IFT172 for6” as the reverse primers. Primers for OCT4 (POU5F1) were purchased from RealTimePrimers.com (Item# VHPS-7107). Realtime PCR was performed using the LightCycler 96 (Roche) and SsoAdvanced Universal SYBR Green Supermix (Bio-rad). Primer concentrations and cycling conditions were optimized for each pair of primers, but most HERV genes and the reference gene were amplified at 95°C 15”, 57°C 15”, 72°C 45”, 78°C 5” for 40 cycles. Fluorescence were read at 78°C. The OCT4 gene was amplified using a touchdown PCR: 95°C 15”, touch down (with annealing temperatures decreasing from 61°C to 58°C in 30 cycles) 45”, 78°C 5” for 50 cycles. 4. Quantification of mRNA Quantities of transcripts were calculated using a modified Pfaffl method (Pfaffl, 2001). Amplification efficiencies were determined with standard curves using serial dilutions of cDNA templates. The ratio between the quantity of the target transcript (T) and that of the reference transcript (R) is calculated for each sample as: where: E R and E T are the efficiencies of the primers for the reference and the target genes, respectively. Ct R and Ct T are the threshold cycle numbers of the reference and the target genes, respectively. 5. Plasmid and constructs In order to analyze the response of retroviral LTRs to sex hormones, entire LTRs were cloned into luciferase reporter plasmids. A solo LTR5HS at 12q13.13 between exons 5 and 6 of the SLC4A8 gene that drives expression of antisense RNA (Gogvadze et al. 2009) was amplified from genomic DNA of T47D cells using CloneAmp HiFi PCR Premix (Clontech). The primers were 5’-ACTGAAGAGGTAGGGGCACT-3’ and 5’- GCTAGGCATGGGGTTATGAA-3’. Similarly, A reversely oriented solo LTR13A in the first intron of the IPTR3 gene (Inositol 1,4,5-Trisphosphate Receptor Type 3 at 6p21.31, NCBI Reference Sequence NG_027729.1) was amplified using primers 5’-GTGGGGCAGGTGACTATCAA-3’ and 5’- GTTGGCACAGGGTGGATTCT-3’. PCR products were verified with restriction fragment analyses. The amplicons were cloned into pMetLuc2-Reporter (Clontech) using the In-Fusion HD Cloning Plus Kit (Clontech), creating pMetLuc2-5HS. Mutant and wild-type LTR5HS from HERVK-con cloned into pGL3 were kindly donated by Dr. Joanna Wysocka. In the mutant, the OCT4 motif was replaced with a NotI site (Grow et al. 2015). 6. Transfections and reporter assays pMetLuc2 encodes a secreted Metridia luciferase, while pGL3 encodes an intracellular firefly luciferease under the con. For luciferase reporter assays, T47D cells were seeded in 12-well plates and treated with estradiol (10 nM) for 24 hours followed by a combination of estradiol (10 nM) and progesterone (1 µM) for 15 hours. Immediately after progesterone was added, cells were transfected with 2.4 µg of the reporter plasmid and 2.4 µg of a control plasmid that constitutively expressed a secreted alkaline phosphatase (pSEAP2-Control) or Metridia luciferase (pMetLuc2- Control). The Xfect Transfection Reagent (Clontech) was used. Activity of secreted Metridia luciferase and alkaline phosphatase were quantified using the Ready-To-Glow™ Dual Secreted Reporter Vector Kit (Clontech). Activity of intracellular firefly luciferase was quantified using the Steady-Luc Firefly HTS Assay Kit (Biotium). 7. siRNA knockdown Small interfering RNA against the human OCT4 (POU5F1) gene was purchased from Origene, along with the transfection reagent, siTran 1.0. T47D cells were cultured in 12-well plates. siRNA or random control RNAwas transfected at 20 nM in the medium using 10 µL of siTran per well. The same wells were transfected twice in consecutive days. Estradiol was added to 10 nM immediately after the second transfection (day 2), and progesterone was added on day 3, 15 hours before harvest. Total cell RNAwas harvested 48 hours after the second transfection on day 4. Knockdown efficiency was evaluated with quantitative PCR using primers for OCT4 mRNA. 8. Activation of HERVK in primary mammary epithelial cells For activating HERVs in primary mammary epithelial cells, cells were cultured in 12-well plates, and treated with decitabine (10 uM) for 2 days, with medium change every day and fresh decitabine added. When cells were 60% confluent, 1 µg of pcDNA_OCT4 (a gift fromDerrick Rossi) was used to transfect each well using siTran 1.0 (Origene) and CombiMag (OZBiosciences). For hormone treatments, estradiol was added to 10-nM after transfection. After 24 hours of estradiol treatment, cells were treated with a combination of estradiol (10 nM) and progesterone (10 nM or 100 nM) for 14-15 hours. Total cell RNA was harvested using RNeasy Plus Mini Kit (Qiagen). Reverse transcription and analysis of the expression of the HERVK10 env gene by quantitative PCR were carried out as described above. 9. Electrophoresis mobility shift assay (EMSA) We performed Electrophoresis Mobility Shift Assays (EMSA) using the Odyssey Infrared EMSA Buffer Kit (LI-COR) to study the interaction between hormones and OCT4 in T47D cells. Crude DNA-free nuclear extract from the T47D breast cancer cell line was used as a source of PR and OCT4. The cells were treated with estradiol (10 nM) for 39 hours. Nuclear extract was prepared using the EpiQuik Nuclear Extraction Kit II (Epigentek). A 27- mer oligonucleotide containing the progesterone-response element (TTAAGGGCGGTGCAAGATGTGCTTTGT, corresponding to nucleotide 186-212 of LTR5HS, with the core sequence underlined) was synthesized and labeled with IRDye700 at the 5’ end (IDT). Another version of the probe with the cytosine of the CG pair methylated (TTAAGGGC m GGTGCAAGATGTGCTTTGT) was labelled with IRDye800. A 25-mer oligonucleotide containing the octamer-binding site (ATTGTCTATGATGCAAAGACCTTTG, corresponding to 681-705 of LTR5HS, with the octamer-binding site underlined) was synthesized and labelled with IRDye800 at the 5’ end. Binding reactions were assembled for a total reaction volume of 20 uL, containing 10 mM Tris, 100 mM KCl, 3.5 mM dithiothreitol, 1 µL of LightShift TM Poly (dI·dC), 500 nM progesterone, 10% glycerol, 50 fmole of each labeled probe, and 4 µg of nuclear extract (unless otherwise indicated). The reaction was incubated at room temperature for 20 minutes. For competition experiments, the unlabeled oligonucleotide was added before Liu and Nguyen ◀ Endogenous Retroviruses ▶ 2018 ICC 192